Ozzy Boids (150x30) Tom Harbin 150x30 Albey's Too Cool Reptiles (150x30) Royal Constrictor Designs (150x30) Dynasty Reptiles (150x30) Ad Space 150x30 (GIF Image)

VPI Book (150x30) John Woolard Reptiles (150x30) VPI (150x30) Ball Python Investments (150x30)

Ben Renick (160x160)

» Top Ball Python Book


The Complete Ball Python
★★★★ (218 ratings 4.8)

John Woolard Reptiles (160x55)
BLBC Advert 160x55
TSK Supply (160x55)
VPI (160x55)
Robinette Reptiles (160x55)
The Reptile Report 160x55
Albey's Too Cool Reptiles (160x55)
TSK Supply (160x55)

» Reptile Classifieds

For Sale small b.p. collection for sale
09-21-2014 04:39 PM
For Sale Enchi Pieds!
09-21-2014 03:27 PM
For Sale Banana Combos - Males and Females
09-20-2014 02:53 PM
Tom Harbin 160x600
Results 1 to 13 of 13

Specter Ball python

This is a discussion on Specter Ball python within the Ball Python Morphs forums, part of the Ball Python Forum category; Is there anyway to tell if a Specter is a specter? There is a guy selling Super stripe offspring. I'm ...

  1. #1
    JAG's Avatar
    JAG
    JAG is offline Bush-League Master Sergeant BLBC Master Sergeant
    Join Date
    Aug 2009
    Location
    Springfield NE (Omaha)
    Posts
    2,485
    Likes
    3
    Rep Power
    214

    Specter Ball python

    Is there anyway to tell if a Specter is a specter? There is a guy selling Super stripe offspring. I'm trying to figure out if any of the males are Specter. he hatched 4 snakes from a Super Stripe X Yellow belly. He got a ivory and the other 3 he is calling Super Stripe offspring. So I am trying to determine if they are Yellow Belly's or Specters. Or am I way off on how all that works? Just thought a Super stripe could not produce normals even if bred to a normal.

    Thanks
    Jeremey

    Ads by Google

  2. Ads by Google
  3. #2
    asplundii's Avatar
    asplundii is offline Bush-League Lieutenant 2nd Lieutenant
    Join Date
    Jan 2009
    Location
    Frederick
    Posts
    3,216
    Likes
    542
    Rep Power
    315
    You are correct that a SS will not produce normals, only YBs and Specters.

    The non-Ivory offspring from the pairing you mention will either be YB or Specter and since YB is the more obvious of the two phenotypes I would go for the least YB looking ones to be likely Specters (but then I have seen some really really "normal" looking YBs so...)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #3
    wonzzer's Avatar
    wonzzer is offline Bush-League Sergeant BLBC Sergeant
    Join Date
    Dec 2008
    Location
    Colorado
    Posts
    716
    Likes
    10
    Rep Power
    220
    Quote Originally Posted by asplundii View Post
    You are correct that a SS will not produce normals, only YBs and Specters.

    The non-Ivory offspring from the pairing you mention will either be YB or Specter and since YB is the more obvious of the two phenotypes I would go for the least YB looking ones to be likely Specters (but then I have seen some really really "normal" looking YBs so...)
    I don't think that's correct, I asked Marshall the same questions, because Cypress Creek Reptiles is selling SS offspring for only 350.00 and we all know that spectors are in the 2,000.00 price range.

    This was Marshalls response :So the super strip is a co_dominate snake. I don’t think they have produced a super yet. But breed a spector to a yellow belly and 25% of the clutch should be super stripe, 25% spector, 25% yellow belly and 25% normals.

    He has Pumas, spectors, so I trust his opinion.

  5. #4
    wonzzer's Avatar
    wonzzer is offline Bush-League Sergeant BLBC Sergeant
    Join Date
    Dec 2008
    Location
    Colorado
    Posts
    716
    Likes
    10
    Rep Power
    220
    OOps, I see it's a SS to ivory, not SS to normal. IDK what the outcome is sorry...

  6. #5
    Chris's Avatar
    Chris is offline Bush-League Lieutenant 2nd Lieutenant
    Join Date
    Nov 2008
    Location
    Miami,Fl
    Posts
    4,553
    Likes
    5
    Rep Power
    261
    Maybe Albey, or Jahluv can answer this question. I think they own spectors.
    Chris Berrios
    ~S.Fl Constrictors~

  7. #6
    The Rev's Avatar
    The Rev is offline Bush-League Sergeant BLBC Sergeant
    Join Date
    Jan 2010
    Location
    MO
    Posts
    656
    Likes
    0
    Rep Power
    182
    Great question! have also been pondering this...
    "When the people fear their government, there is tyranny; when the government fears the people, there is liberty."
    -Thomas Jefferson-

  8. #7
    Albey's Avatar
    Albey is offline Bush-League Staff Sergeant BLBC Staff Sergeant
    Join Date
    Oct 2008
    Location
    Atlanta, GA
    Posts
    1,475
    Likes
    43
    Rep Power
    236
    Quote Originally Posted by Chris View Post
    Maybe Albey, or Jahluv can answer this question. I think they own spectors.
    So far the general consensus among those that have been working with Superstripes for a while (that does not include me by the way ), is that the Yellow Belly gene and the Specter gene are on the same allele. A Superstripe is the Super of those two genes combined. If this is in fact true a Superstripe when bred to a Normal can only produce Yellow Belly’s and Specters, no Normals but also no Superstripes. A Superstripe bred to a Yellow Belly can produce Superstripes, Ivories, Specters, and Yellow Belly’s, no Normals. If you are absolutely certain that the offspring are from a Superstripe to a Yellow Belly with no chance of retained sperm from either another breeding or breeding from the year before, the “Super Stripe offspring” (that are not obvious Yellow Belly’s) have to be Specters.
    Albey
    Albey's "Too Cool" Reptiles
    Like us on Facebook

  9. #8
    Jah Luv's Avatar
    Jah Luv is offline Bush-League Lieutenant 2nd Lieutenant
    Join Date
    Feb 2009
    Location
    CT
    Posts
    5,659
    Likes
    5
    Rep Power
    264
    Quote Originally Posted by Albey View Post
    So far the general consensus among those that have been working with Superstripes for a while (that does not include me by the way ), is that the Yellow Belly gene and the Specter gene are on the same allele. A Superstripe is the Super of those two genes combined. If this is in fact true a Superstripe when bred to a Normal can only produce Yellow Belly’s and Specters, no Normals but also no Superstripes. A Superstripe bred to a Yellow Belly can produce Superstripes, Ivories, Specters, and Yellow Belly’s, no Normals. If you are absolutely certain that the offspring are from a Superstripe to a Yellow Belly with no chance of retained sperm from either another breeding or breeding from the year before, the “Super Stripe offspring” (that are not obvious Yellow Belly’s) have to be Specters.
    Very well said..

  10. #9
    KMS's Avatar
    KMS
    KMS is offline Bush-League Master Sergeant BLBC Master Sergeant
    Join Date
    Nov 2008
    Location
    Southeastern Michigan
    Posts
    1,701
    Likes
    0
    Rep Power
    236
    I concur...
    Kevin Stoltz

  11. #10
    JAG's Avatar
    JAG
    JAG is offline Bush-League Master Sergeant BLBC Master Sergeant
    Join Date
    Aug 2009
    Location
    Springfield NE (Omaha)
    Posts
    2,485
    Likes
    3
    Rep Power
    214
    What does the belly of a specter look like? Is it similer to yellow belly or diffrent?

  12. #11
    Albey's Avatar
    Albey is offline Bush-League Staff Sergeant BLBC Staff Sergeant
    Join Date
    Oct 2008
    Location
    Atlanta, GA
    Posts
    1,475
    Likes
    43
    Rep Power
    236
    Quote Originally Posted by JAG View Post
    What does the belly of a specter look like? Is it similer to yellow belly or diffrent?
    Here are shots of two different Specters.





    Here is one of a Yellow Belly.

    Albey
    Albey's "Too Cool" Reptiles
    Like us on Facebook

  13. #12
    JAG's Avatar
    JAG
    JAG is offline Bush-League Master Sergeant BLBC Master Sergeant
    Join Date
    Aug 2009
    Location
    Springfield NE (Omaha)
    Posts
    2,485
    Likes
    3
    Rep Power
    214
    Thanks Albey! Big help.

  14. #13
    asplundii's Avatar
    asplundii is offline Bush-League Lieutenant 2nd Lieutenant
    Join Date
    Jan 2009
    Location
    Frederick
    Posts
    3,216
    Likes
    542
    Rep Power
    315
    Quote Originally Posted by Albey View Post
    So far the general consensus among those that have been working with Superstripes for a while (that does not include me by the way ), is that the Yellow Belly gene and the Specter gene are on the same allele. A Superstripe is the Super of those two genes combined. If this is in fact true a Superstripe when bred to a Normal can only produce Yellow Belly’s and Specters, no Normals but also no Superstripes. A Superstripe bred to a Yellow Belly can produce Superstripes, Ivories, Specters, and Yellow Belly’s, no Normals. If you are absolutely certain that the offspring are from a Superstripe to a Yellow Belly with no chance of retained sperm from either another breeding or breeding from the year before, the “Super Stripe offspring” (that are not obvious Yellow Belly’s) have to be Specters.
    Quote Originally Posted by Jah Luv View Post
    Very well said..

    That's what I said, just not as verbose

    But it is more correct (genetically speaking) to say that Specter and YB are alleles of the same gene. But that is just me being anal about genetics lingo
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Similar Threads

  1. Woma python x albino ball python???
    By Jack Yang in forum Ball Python Pictures
    Replies: 7
    Last Post: 08-06-2012, 06:24 AM
  2. really dumb ball python ad (Snake "bald python")
    By snakeden80 in forum Industry Watchdog!
    Replies: 7
    Last Post: 07-18-2012, 12:57 AM
  3. new ball python
    By 147BOAS in forum Ball Python Pictures
    Replies: 12
    Last Post: 11-08-2009, 09:15 PM
  4. Ball Python $$$ ????
    By FRoberts in forum Ball Python Morphs
    Replies: 21
    Last Post: 11-07-2009, 01:03 PM
  5. Ball Python First Aid Kit
    By Tosha in forum Ball Python Care
    Replies: 12
    Last Post: 02-27-2009, 04:43 PM
Powered by vBadvanced CMPS v4.2.1